Transcript: Human NM_198514.4

Homo sapiens NHL repeat containing 2 (NHLRC2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NHLRC2 (374354)
Length:
11051
CDS:
213..2393

Additional Resources:

NCBI RefSeq record:
NM_198514.4
NBCI Gene record:
NHLRC2 (374354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303767 AGTTACTGATAGATTGGTAAT pLKO_005 911 CDS 100% 10.800 15.120 N NHLRC2 n/a
2 TRCN0000064215 CCTATGGTTAATGATGCAGAT pLKO.1 642 CDS 100% 4.050 5.670 N NHLRC2 n/a
3 TRCN0000064217 GCCACCTTCACCATTGCTATT pLKO.1 866 CDS 100% 10.800 8.640 N NHLRC2 n/a
4 TRCN0000064213 CGGCTAAGTTTCCAAATGAAA pLKO.1 571 CDS 100% 5.625 4.500 N NHLRC2 n/a
5 TRCN0000217826 CTTCACCTACTGCTGCATAAA pLKO.1 467 CDS 100% 13.200 9.240 N Nhlrc2 n/a
6 TRCN0000310768 TCCACAGGGTGTAGCCATAAT pLKO_005 1052 CDS 100% 13.200 9.240 N NHLRC2 n/a
7 TRCN0000310766 TGAACACAGAAGAACCTATTT pLKO_005 403 CDS 100% 13.200 9.240 N NHLRC2 n/a
8 TRCN0000303766 ATGTTGCAGACTCCTACAATC pLKO_005 1681 CDS 100% 10.800 7.560 N NHLRC2 n/a
9 TRCN0000064214 CCTGATGATTGCTTATCACTT pLKO.1 2220 CDS 100% 4.950 3.465 N NHLRC2 n/a
10 TRCN0000299817 CCTGATGATTGCTTATCACTT pLKO_005 2220 CDS 100% 4.950 3.465 N NHLRC2 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 8280 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4317 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4244 3UTR 100% 4.950 2.475 Y n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4317 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198514.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13625 pDONR223 100% 50.5% 50.5% None 1_1077del n/a
2 ccsbBroad304_13625 pLX_304 0% 50.5% 50.5% V5 1_1077del n/a
3 TRCN0000472285 ACACGACGCCCATAGGCCCGACGT pLX_317 52.6% 50.5% 50.5% V5 1_1077del n/a
Download CSV