Transcript: Human NM_198557.3

Homo sapiens RNA binding motif protein 43 (RBM43), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
RBM43 (375287)
Length:
4176
CDS:
137..1210

Additional Resources:

NCBI RefSeq record:
NM_198557.3
NBCI Gene record:
RBM43 (375287)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152681 GCTGTAACTCTAGGACTAATT pLKO.1 2324 3UTR 100% 13.200 18.480 N RBM43 n/a
2 TRCN0000157786 CCGTATTAGTGAAGAGCCACT pLKO.1 234 CDS 100% 2.160 3.024 N RBM43 n/a
3 TRCN0000156551 GCAGTGACCATTGCCATGAAT pLKO.1 1256 3UTR 100% 5.625 4.500 N RBM43 n/a
4 TRCN0000428993 GATGTTGAAGATGTGATATAT pLKO_005 281 CDS 100% 15.000 10.500 N RBM43 n/a
5 TRCN0000414104 GAACAATTAAGTTCGAGATAC pLKO_005 1076 CDS 100% 10.800 7.560 N RBM43 n/a
6 TRCN0000155060 GCAGAGAATGTCATCAGACAA pLKO.1 353 CDS 100% 4.950 3.465 N RBM43 n/a
7 TRCN0000157014 GCTCCTGAAAGAACGGTTGTA pLKO.1 170 CDS 100% 4.950 3.465 N RBM43 n/a
8 TRCN0000155985 CGTATTAGTGAAGAGCCACTT pLKO.1 235 CDS 100% 4.050 2.835 N RBM43 n/a
9 TRCN0000414313 ATCTCCGTGGAAGGATCATTT pLKO_005 584 CDS 100% 13.200 7.920 N RBM43 n/a
10 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 2508 3UTR 100% 4.050 2.025 Y LOC441087 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1759 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1759 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05544 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05544 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475528 CGGAATCGTCTCACAGAGAGCTTG pLX_317 25.5% 100% 100% V5 n/a
Download CSV