Transcript: Human NM_198580.3

Homo sapiens solute carrier family 27 member 1 (SLC27A1), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SLC27A1 (376497)
Length:
3514
CDS:
18..1958

Additional Resources:

NCBI RefSeq record:
NM_198580.3
NBCI Gene record:
SLC27A1 (376497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435994 GTTCCTCTACTGGCCACAAAC pLKO_005 1963 3UTR 100% 10.800 7.560 N SLC27A1 n/a
2 TRCN0000420136 CTCAGGTGACGTGCTAGTGAT pLKO_005 1484 CDS 100% 4.950 3.465 N SLC27A1 n/a
3 TRCN0000038185 GCCCTTAAATGAGGCAGTCTA pLKO.1 1904 CDS 100% 4.950 3.465 N SLC27A1 n/a
4 TRCN0000038186 AGGCACCTTCAAGATCCAGAA pLKO.1 1799 CDS 100% 4.050 2.835 N SLC27A1 n/a
5 TRCN0000038188 CATTGCCAACATGGACGGCAA pLKO.1 1202 CDS 100% 0.216 0.151 N SLC27A1 n/a
6 TRCN0000038184 CCCTGATCTTTGGAGGAGAAA pLKO.1 550 CDS 100% 4.950 2.970 N SLC27A1 n/a
7 TRCN0000038187 CTTCGGTCTCTCTGTGCTGAT pLKO.1 182 CDS 100% 4.050 2.430 N SLC27A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489207 GATACCGTAGCAGTACGCCACGAT pLX_317 17.3% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV