Transcript: Human NM_198849.3

Homo sapiens siah E3 ubiquitin protein ligase family member 3 (SIAH3), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SIAH3 (283514)
Length:
7075
CDS:
125..934

Additional Resources:

NCBI RefSeq record:
NM_198849.3
NBCI Gene record:
SIAH3 (283514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073239 GCCGGCTGATTGGATCATCAT pLKO.1 580 CDS 100% 4.950 6.930 N SIAH3 n/a
2 TRCN0000414279 GTCTGCCATGGGCATTATATT pLKO_005 1102 3UTR 100% 15.000 10.500 N SIAH3 n/a
3 TRCN0000414731 CTATTTCAGAGCAAGCTAAAT pLKO_005 1342 3UTR 100% 13.200 9.240 N SIAH3 n/a
4 TRCN0000422238 GGCTTCGTGTGAGAATCATTT pLKO_005 1303 3UTR 100% 13.200 9.240 N SIAH3 n/a
5 TRCN0000423480 GGGCTGTATTAGATCTCATTC pLKO_005 150 CDS 100% 10.800 7.560 N SIAH3 n/a
6 TRCN0000073242 CTGCGGCAGATCCATAGGGTT pLKO.1 503 CDS 100% 0.880 0.616 N SIAH3 n/a
7 TRCN0000073238 GCGAGACTTCATTTCTACAAA pLKO.1 3851 3UTR 100% 5.625 3.375 N SIAH3 n/a
8 TRCN0000073240 AGGAAACAGGAGAGGCATGAA pLKO.1 638 CDS 100% 4.950 2.970 N SIAH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198849.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.