Transcript: Mouse NM_198962.3

Mus musculus hypocretin (orexin) receptor 2 (Hcrtr2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hcrtr2 (387285)
Length:
3728
CDS:
75..1457

Additional Resources:

NCBI RefSeq record:
NM_198962.3
NBCI Gene record:
Hcrtr2 (387285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027852 CGGTGAAGTTTACCCAAAGAT pLKO.1 719 CDS 100% 5.625 7.875 N Hcrtr2 n/a
2 TRCN0000027814 CGCAGGGTATATCATCGTGTT pLKO.1 248 CDS 100% 4.050 5.670 N Hcrtr2 n/a
3 TRCN0000027817 GCAACTTTGACAATGTATCAA pLKO.1 1306 CDS 100% 5.625 3.938 N Hcrtr2 n/a
4 TRCN0000027841 GCCAATAAGACCACCCTCTTT pLKO.1 675 CDS 100% 4.950 3.465 N Hcrtr2 n/a
5 TRCN0000027798 CCTCTGTAAGGTCATTCCTTA pLKO.1 449 CDS 100% 0.495 0.347 N Hcrtr2 n/a
6 TRCN0000357471 CAATTTGCTATCTACCAATTA pLKO_005 1015 CDS 100% 13.200 9.240 N HCRTR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198962.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489370 AAGTAGCTGAAACAACCTACGTTC pLX_317 28.6% 84.6% 91.1% V5 (many diffs) n/a
2 TRCN0000487861 TCCATACTCTCCCACAGATCGTAG pLX_317 21.6% 84.6% 91.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV