Transcript: Mouse NM_199032.2

Mus musculus centrosomal protein 135 (Cep135), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cep135 (381644)
Length:
5334
CDS:
46..3468

Additional Resources:

NCBI RefSeq record:
NM_199032.2
NBCI Gene record:
Cep135 (381644)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102218 GCGGAGATCTTGTGCGATTAA pLKO.1 1452 CDS 100% 13.200 18.480 N Cep135 n/a
2 TRCN0000446407 CATAGAGGAAGAGCGCGATTA pLKO_005 1392 CDS 100% 10.800 15.120 N Cep135 n/a
3 TRCN0000446403 TAACCGAGATCGACCAGTTAG pLKO_005 1001 CDS 100% 10.800 15.120 N Cep135 n/a
4 TRCN0000102215 GCTTTAATAATCTGTGCCTTA pLKO.1 3793 3UTR 100% 4.050 3.240 N Cep135 n/a
5 TRCN0000428066 GAAGGATTCTTGCACTATTTA pLKO_005 3835 3UTR 100% 15.000 10.500 N Cep135 n/a
6 TRCN0000102217 GCAGATGTCAAACGAGAAGTA pLKO.1 3339 CDS 100% 4.950 3.465 N Cep135 n/a
7 TRCN0000102216 GCGCGTTATCTGAGTTGAGAA pLKO.1 1763 CDS 100% 4.950 3.465 N Cep135 n/a
8 TRCN0000102219 CCAGTATGTTCACAAGGTCAA pLKO.1 411 CDS 100% 4.050 2.835 N Cep135 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199032.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.