Transcript: Human NM_199050.3

Homo sapiens C2 calcium dependent domain containing 2 (C2CD2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
C2CD2 (25966)
Length:
5857
CDS:
220..1845

Additional Resources:

NCBI RefSeq record:
NM_199050.3
NBCI Gene record:
C2CD2 (25966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199050.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136888 CCATTCGACAGCTCAGTGAAT pLKO.1 1229 CDS 100% 4.950 6.930 N C2CD2 n/a
2 TRCN0000136846 CGAGTTGAATGCCAAGTCGAA pLKO.1 708 CDS 100% 2.640 3.696 N C2CD2 n/a
3 TRCN0000134342 GTAAAGGAAGCTCAGAACTTA pLKO.1 460 CDS 100% 5.625 3.938 N C2CD2 n/a
4 TRCN0000134095 CAGTGAATCTTCAAAGCTGAA pLKO.1 1242 CDS 100% 4.050 2.835 N C2CD2 n/a
5 TRCN0000136889 CTTTCATCAGTGTGCCGGAAA pLKO.1 296 CDS 100% 4.050 2.835 N C2CD2 n/a
6 TRCN0000137475 GAAGGAGTTACACCTGCAGAT pLKO.1 726 CDS 100% 4.050 2.835 N C2CD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199050.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11792 pDONR223 100% 69.7% 66.7% None (many diffs) n/a
2 ccsbBroad304_11792 pLX_304 0% 69.7% 66.7% V5 (many diffs) n/a
3 TRCN0000472139 CTGTATTCCGTGGTCCGCTTAAGA pLX_317 38.5% 69.7% 66.7% V5 (many diffs) n/a
Download CSV