Transcript: Human NM_199124.2

Homo sapiens junctional cadherin complex regulator (JHY), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
JHY (79864)
Length:
2130
CDS:
535..1458

Additional Resources:

NCBI RefSeq record:
NM_199124.2
NBCI Gene record:
JHY (79864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136324 CGCAAGAGATTATGTGCCATT pLKO.1 686 CDS 100% 4.050 5.670 N JHY n/a
2 TRCN0000284373 CTGTCCTTCATACCAACTTAA pLKO_005 578 CDS 100% 13.200 9.240 N JHY n/a
3 TRCN0000136960 CGGCGAAGGAAATCCAAACAA pLKO.1 1273 CDS 100% 5.625 3.938 N JHY n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1833 3UTR 100% 13.200 6.600 Y LIAS n/a
5 TRCN0000157476 GCCAACATGGTGAAACCCAAT pLKO.1 1905 3UTR 100% 4.050 2.025 Y NFASC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199124.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14273 pDONR223 100% 82.3% 82% None 1_162del;910T>G n/a
2 ccsbBroad304_14273 pLX_304 0% 82.3% 82% V5 1_162del;910T>G n/a
3 TRCN0000473635 CTGCGACGCGGTACTGACGAATAT pLX_317 70.7% 82.3% 82% V5 1_162del;910T>G n/a
Download CSV