Transcript: Human NM_199165.2

Homo sapiens adenylosuccinate synthase 1 (ADSS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ADSS1 (122622)
Length:
1884
CDS:
50..1552

Additional Resources:

NCBI RefSeq record:
NM_199165.2
NBCI Gene record:
ADSS1 (122622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257301 ACGTGGGAGTCGCAGTCAAAT pLKO_005 1485 CDS 100% 13.200 18.480 N ADSS1 n/a
2 TRCN0000232447 GACGTACTGGGTGAGGTTAAA pLKO_005 1280 CDS 100% 13.200 18.480 N ADSS1 n/a
3 TRCN0000232448 TGTTGGTTTCTACAATGATTT pLKO_005 1690 3UTR 100% 13.200 9.240 N ADSS1 n/a
4 TRCN0000232445 AGAACATAGGTGACGTGTATG pLKO_005 1044 CDS 100% 10.800 7.560 N ADSS1 n/a
5 TRCN0000232446 CCGAGCAGATCAACGAGATTG pLKO_005 1113 CDS 100% 10.800 7.560 N ADSS1 n/a
6 TRCN0000045827 ACCCTGGAAATAGACATTGAA pLKO.1 803 CDS 100% 5.625 3.938 N ADSS1 n/a
7 TRCN0000045826 AGGTCGAAGTTGAGTATGAAA pLKO.1 1371 CDS 100% 5.625 3.938 N ADSS1 n/a
8 TRCN0000045823 CGACCTGATGATTCTAAGATA pLKO.1 1204 CDS 100% 5.625 3.938 N ADSS1 n/a
9 TRCN0000045825 GAGCCCACCTTGTGTTTGATT pLKO.1 576 CDS 100% 5.625 3.938 N ADSS1 n/a
10 TRCN0000045824 CGGTGTCTCATACAAGCTGAA pLKO.1 1303 CDS 100% 4.050 2.835 N ADSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04764 pDONR223 100% 87% 79.5% None (many diffs) n/a
2 ccsbBroad304_04764 pLX_304 0% 87% 79.5% V5 (many diffs) n/a
3 TRCN0000467923 AATTAGAACGCCTTGCGTCCCTCC pLX_317 30.7% 87% 79.5% V5 (many diffs) n/a
4 TRCN0000488916 AAGTGTTATCCTCTACTTTAGATG pLX_317 25.3% 87% 79.3% V5 (many diffs) n/a
5 TRCN0000488996 TTTATAATACATGACCAGAGGCAT pLX_317 30.6% 86.6% 79.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV