Transcript: Mouse NM_199200.2

Mus musculus family with sequence similarity 171, member A2 (Fam171a2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Fam171a2 (217219)
Length:
3099
CDS:
149..2617

Additional Resources:

NCBI RefSeq record:
NM_199200.2
NBCI Gene record:
Fam171a2 (217219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202022 CAACGTGTACCGCAATGTCAT pLKO.1 1735 CDS 100% 4.950 6.930 N Fam171a2 n/a
2 TRCN0000190133 CATTGGCACCTACCACACAAT pLKO.1 1075 CDS 100% 4.950 3.465 N Fam171a2 n/a
3 TRCN0000189569 CGAAATGGCACTGGTGTGATT pLKO.1 938 CDS 100% 4.950 3.465 N Fam171a2 n/a
4 TRCN0000202372 GTGCTCATTCTGCTGTGTCTA pLKO.1 1133 CDS 100% 4.950 3.465 N Fam171a2 n/a
5 TRCN0000189965 GATCCTGGAGACTAGAGGATA pLKO.1 3028 3UTR 100% 0.495 0.347 N Fam171a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199200.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13513 pDONR223 100% 8.6% 2.6% None (many diffs) n/a
2 ccsbBroad304_13513 pLX_304 0% 8.6% 2.6% V5 (many diffs) n/a
3 TRCN0000474149 ATCTGTCATATTCATTACAGTATA pLX_317 100% 8.6% 2.6% V5 (many diffs) n/a
Download CSV