Transcript: Human NM_199227.3

Homo sapiens methionyl aminopeptidase type 1D, mitochondrial (METAP1D), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
METAP1D (254042)
Length:
3049
CDS:
18..1025

Additional Resources:

NCBI RefSeq record:
NM_199227.3
NBCI Gene record:
METAP1D (254042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052159 CCGCAGAGGTTCTCATAGAAT pLKO.1 50 CDS 100% 5.625 7.875 N METAP1D n/a
2 TRCN0000052160 CCACTCAATCATATCTACTTA pLKO.1 81 CDS 100% 5.625 4.500 N METAP1D n/a
3 TRCN0000052158 CGGGAAATCATCAGTCATAAT pLKO.1 405 CDS 100% 13.200 9.240 N METAP1D n/a
4 TRCN0000429998 GGACATGGAATAGGATCTTAC pLKO_005 768 CDS 100% 10.800 7.560 N METAP1D n/a
5 TRCN0000052162 CATCATGCAAACGACAGTGAT pLKO.1 813 CDS 100% 4.950 3.465 N METAP1D n/a
6 TRCN0000052161 CTCTGTAATTGGAAACACAAT pLKO.1 698 CDS 100% 4.950 3.465 N METAP1D n/a
7 TRCN0000430391 ATGGAGATATTATCAACATTG pLKO_005 529 CDS 100% 10.800 6.480 N METAP1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05297 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05297 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476162 GGTTCCATCTAAAGTGATAGATCC pLX_317 31.7% 100% 100% V5 n/a
Download CSV