Transcript: Human NM_199282.3

Homo sapiens Rho GTPase activating protein 27 (ARHGAP27), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP27 (201176)
Length:
3631
CDS:
437..2083

Additional Resources:

NCBI RefSeq record:
NM_199282.3
NBCI Gene record:
ARHGAP27 (201176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415191 CCCTCGAAGCATCCATAAATC pLKO_005 757 CDS 100% 13.200 18.480 N ARHGAP27 n/a
2 TRCN0000454952 TATTCTCCCGTGGGCTCTTTC pLKO_005 536 CDS 100% 10.800 8.640 N ARHGAP27 n/a
3 TRCN0000048354 CCATCCAGAAGCTACGCTATA pLKO.1 1632 CDS 100% 10.800 7.560 N ARHGAP27 n/a
4 TRCN0000048356 AGACAAATCCAGTAGGAAGAA pLKO.1 1126 CDS 100% 4.950 3.465 N ARHGAP27 n/a
5 TRCN0000048355 CCAGTTCATTGCGGCCATCAA pLKO.1 1780 CDS 100% 4.950 3.465 N ARHGAP27 n/a
6 TRCN0000048353 CGGGAAGCCATACTTCTACAA pLKO.1 685 CDS 100% 4.950 3.465 N ARHGAP27 n/a
7 TRCN0000423320 GTGGCGTCCTGACATTCTTCA pLKO_005 999 CDS 100% 4.950 3.465 N ARHGAP27 n/a
8 TRCN0000048357 CAAGCAGATGCTCTACACCAA pLKO.1 622 CDS 100% 2.640 1.848 N ARHGAP27 n/a
9 TRCN0000417582 CCCTAGTGGGCAGTTTGCAAA pLKO_005 2241 3UTR 100% 4.950 2.970 N ARHGAP27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199282.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466675 GTACCCCAGTCATAGTGCGCCCTT pLX_317 22.4% 99.7% 99.4% V5 14T>C;16_17delAGinsCC;932C>G n/a
Download CSV