Transcript: Human NM_199296.3

Homo sapiens isthmin 2 (ISM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ISM2 (145501)
Length:
2940
CDS:
24..1739

Additional Resources:

NCBI RefSeq record:
NM_199296.3
NBCI Gene record:
ISM2 (145501)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117888 GCTACGGACATGCATGATCAA pLKO.1 1200 CDS 100% 4.950 3.960 N ISM2 n/a
2 TRCN0000373765 CTGCAAGAGCGACTTCCTAAT pLKO_005 1250 CDS 100% 10.800 7.560 N ISM2 n/a
3 TRCN0000373767 CTGCAGAAGCTGCCAGAATTG pLKO_005 591 CDS 100% 10.800 7.560 N ISM2 n/a
4 TRCN0000373766 AGCACCGACTTCTCACCTAAG pLKO_005 1563 CDS 100% 6.000 4.200 N ISM2 n/a
5 TRCN0000117887 CCCTCTGTTCTGCTGATTGTA pLKO.1 2448 3UTR 100% 5.625 3.938 N ISM2 n/a
6 TRCN0000117889 CAGAGCTACACCAACATGGAT pLKO.1 484 CDS 100% 3.000 2.100 N ISM2 n/a
7 TRCN0000117891 CCAACATGGATGTTGGACTGT pLKO.1 494 CDS 100% 0.264 0.185 N ISM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09623 pDONR223 100% 99.9% 99.8% None 280G>A n/a
2 ccsbBroad304_09623 pLX_304 0% 99.9% 99.8% V5 280G>A n/a
3 TRCN0000465856 AGGATCTGTGCCCGTCGTTCTCTC pLX_317 22.6% 99.9% 99.8% V5 280G>A n/a
Download CSV