Transcript: Mouse NM_199308.2

Mus musculus microtubule associated serine/threonine kinase 3 (Mast3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mast3 (546071)
Length:
5334
CDS:
120..4037

Additional Resources:

NCBI RefSeq record:
NM_199308.2
NBCI Gene record:
Mast3 (546071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367266 CAAGCCCTCGCGACTAATTTA pLKO_005 4182 3UTR 100% 15.000 21.000 N Mast3 n/a
2 TRCN0000022974 GTGCAGGAGGTGAGCTTCGAT pLKO.1 3924 CDS 100% 1.000 0.800 N Mast3 n/a
3 TRCN0000367267 TCTGGTCACTTCCCGCTATTT pLKO_005 833 CDS 100% 13.200 9.240 N Mast3 n/a
4 TRCN0000022976 TCGGGATTCCTTCAAGAAGCA pLKO.1 3896 CDS 100% 2.640 1.848 N Mast3 n/a
5 TRCN0000022975 CCCAGGACATGCCAGGAAAGA pLKO.1 4013 CDS 100% 1.650 1.155 N Mast3 n/a
6 TRCN0000022978 GTGAGCTTCGATGAGGAGCCT pLKO.1 3933 CDS 100% 0.220 0.154 N Mast3 n/a
7 TRCN0000197052 GCGACTTTGAGACCATCAAAC pLKO.1 1231 CDS 100% 1.080 0.864 N MAST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489717 TTTCATTAGAAACCTGAATTGTAC pLX_317 17.5% 42.4% 45.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491941 ATCCCACGGCATTCTGCCTCAGCT pLX_317 21.1% 42.4% 45.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV