Construct: ORF TRCN0000491941
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020484.2_s317c1
- DNA Barcode:
- ATCCCACGGCATTCTGCCTCAGCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MAST3 (23031)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491941
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23031 | MAST3 | microtubule associated seri... | XM_006722698.2 | 52.7% | 51.5% | (many diffs) |
| 2 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026514.1 | 52.7% | 51.5% | (many diffs) |
| 3 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026515.1 | 52.7% | 51.5% | (many diffs) |
| 4 | human | 23031 | MAST3 | microtubule associated seri... | NM_015016.2 | 50.1% | 48.9% | (many diffs) |
| 5 | human | 23031 | MAST3 | microtubule associated seri... | XM_006722700.3 | 49.9% | 48.7% | (many diffs) |
| 6 | human | 23031 | MAST3 | microtubule associated seri... | XM_005259827.3 | 49.8% | 48.7% | (many diffs) |
| 7 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026513.1 | 49.8% | 48.6% | (many diffs) |
| 8 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026512.1 | 49.7% | 48.6% | (many diffs) |
| 9 | human | 23031 | MAST3 | microtubule associated seri... | XM_005259826.3 | 49.5% | 48.4% | (many diffs) |
| 10 | human | 23031 | MAST3 | microtubule associated seri... | XM_005259825.2 | 49.5% | 48.3% | (many diffs) |
| 11 | human | 23031 | MAST3 | microtubule associated seri... | XM_005259824.2 | 49.5% | 48.3% | (many diffs) |
| 12 | human | 23031 | MAST3 | microtubule associated seri... | XM_005259823.3 | 49.2% | 48.1% | (many diffs) |
| 13 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026511.1 | 48.7% | 47.5% | (many diffs) |
| 14 | human | 23031 | MAST3 | microtubule associated seri... | XM_011527823.1 | 48.4% | 47.2% | (many diffs) |
| 15 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026510.2 | 46.7% | 45.6% | (many diffs) |
| 16 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026516.1 | 46.5% | 45.4% | (many diffs) |
| 17 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026509.1 | 46.5% | 45.4% | (many diffs) |
| 18 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026508.1 | 46.5% | 45.4% | (many diffs) |
| 19 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026507.1 | 46.4% | 45.3% | (many diffs) |
| 20 | human | 23031 | MAST3 | microtubule associated seri... | XM_017026506.1 | 46.2% | 45.1% | (many diffs) |
| 21 | human | 23031 | MAST3 | microtubule associated seri... | XM_006722699.2 | 46.2% | 45.1% | (many diffs) |
| 22 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_011242315.1 | 46.3% | 49.5% | (many diffs) |
| 23 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509713.3 | 42.4% | 45.3% | (many diffs) |
| 24 | mouse | 546071 | Mast3 | microtubule associated seri... | NM_199308.2 | 42.4% | 45.3% | (many diffs) |
| 25 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509712.3 | 42.2% | 45.1% | (many diffs) |
| 26 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_017312912.1 | 42.2% | 45.1% | (many diffs) |
| 27 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_017312911.1 | 41.9% | 44.7% | (many diffs) |
| 28 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509711.2 | 41.8% | 44.7% | (many diffs) |
| 29 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_017312910.1 | 41.8% | 44.7% | (many diffs) |
| 30 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_017312909.1 | 41.7% | 44.5% | (many diffs) |
| 31 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_017312908.1 | 41.6% | 44.4% | (many diffs) |
| 32 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509710.2 | 40.9% | 43.7% | (many diffs) |
| 33 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509709.2 | 40.9% | 43.7% | (many diffs) |
| 34 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509708.2 | 40.7% | 43.5% | (many diffs) |
| 35 | mouse | 546071 | Mast3 | microtubule associated seri... | XM_006509707.2 | 40.7% | 43.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 2040
- ORF length:
- 1968
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgaatcac gtgtaccggg agaggttccc caaggccaca gcacagatgg 121 agggccgtct gcaggagttc ctgacggcct acgcgcccgg cgcccggctg gcgctggctg 181 atggcgtctt gggcttcatc caccaccaga tcgtcgagct ggcccgagac tgcttggcca 241 agtctggcga gaacctcgtc acctcccgct acttcctaga gatgcaggag aagctggagc 301 ggcttctgca ggatgcccat gagcgttcgg acagtgagga ggtcagcttc atcgtccagc 361 ttgtccggaa actgctgatc atcatctcac ggccagctcg gctgctggag tgtctggagt 421 ttgaccctga ggaattttac cacctgctgg aggcggctga gggccatgcg cgggagggcc 481 aaggcattaa gactgacctt ccacagtaca tcattgggca gctgggcctg gccaaggacc 541 ccctggagga gatggtgcca ctgagtcacc tcgaagaaga acagccccca gcacctgagt 601 ccccagagag ccgcgccctg gtcggccagt cacggaggaa gccatgcgaa agcgactttg 661 agaccatcaa actcattagc aacggagcct atggggccgt ctacctggtg cggcaccgtg 721 acacacggca gcgctttgcc atcaagaaga tcaacaaaca gaacttgatc ctgcgtaacc 781 agatccagca ggtctttgtg gagcgtgaca ttctcacctt tgccgagaac ccctttgtgg 841 tcagcatgtt ctgctccttt gagacccggc gccacctatg tatggtcatg gaatacgtgg 901 aaggcggcga ctgcgccacg ctcctgaaga acatgggccc gctgcccgtg gacatggccc 961 gcctgtactt cgccgagacg gtgttggcgc tggagtacct gcataactat ggcatcgtgc 1021 accgtgacct caaaccagac aatctgctca tcacctcgct tggccacatc aagctcacgg 1081 acttcggcct gtccaagatc ggcctcatga gcatggccac caacctctat gagggccaca 1141 tcgagaagga cgcccgagag ttcatcgaca agcaggtgtg tgggacgccg gagtacatag 1201 cccccgaggt gatcttccgc cagggctatg ggaagccagt ggactggtgg gccatgggcg 1261 tcgtcctcta tgagtttctg gtgggctgcg tgcctttctt tggagatacc cccgaggaac 1321 tcttcggtca ggtggtcagc gatgagatca tgtggccaga gggagatgag gcccttccag 1381 cagacgccca ggacctcatc accaggttgc tccggcagag cccgctggac cgtctgggca 1441 ctggtggcac ccacgaagtg aagcagcacc cctttttcct ggccctggac tgggcagggc 1501 ttctccgaca caaagccgag ttcgtgcccc agctcgaagc cgaggatgat accagctact 1561 ttgacacacg ttcggaacgt taccgccatc tgggctccga ggacgacgag accaatgatg 1621 aagaatcgtc cacagagatc ccccagttct ccTCCTGCTC CCACCGGTTC AGCAAGGTCT 1681 ACAGCAGCTC TGAGTTCCTG GCCGTCCAGC CCACTCCTAC CTTCGCTGAA AGGAGCTTCA 1741 GTGAAGACCG GGAGGAGGGG TGGGAGCGCA GCGAAGTGGA CTATGGCCGC CGGCTGAGTG 1801 CTGACATCCG GCTGAGGTCC TGGACATCCT CTGGATCCTC CTGTCAGTCA TCTTCGTCCC 1861 AGCCCGAGCG GGGTCCCAGC CCATCTCTCC TGAATACCAT CAGCCTGGAC ACAATGCCCA 1921 AGTTTGCCTT CTCATCAGAG GATGAGGGGG TAGGCCCAGG CCCTGCAGGC CCCAAGAGGC 1981 CACTGGGCTG CCCACCTCAG TGCCACAGAT CGCCGTGGAG GGCGAGGAAG CCGTGCCAGT 2041 AGCTCTCGGG CCCACCGGAA GAGACTAGGA CCCAGCTTTC TTGTACAAAG TGGTTGATAT 2101 CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC 2161 GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAATCCCA 2221 CGGCATTCTG CCTCAGCTAC GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt 2281 gaaagatt