Transcript: Mouse NM_199310.2

Mus musculus coiled-coil domain containing 32 (Ccdc32), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ccdc32 (269336)
Length:
1870
CDS:
84..623

Additional Resources:

NCBI RefSeq record:
NM_199310.2
NBCI Gene record:
Ccdc32 (269336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_199310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216162 CAAGAAGATGTTTCCGACAAT pLKO.1 174 CDS 100% 4.950 6.930 N Ccdc32 n/a
2 TRCN0000178061 GAGAAGTTAGCATCAGAGTTT pLKO.1 435 CDS 100% 4.950 3.960 N Ccdc32 n/a
3 TRCN0000216201 CATGATTCAGAAGTGTATTTA pLKO.1 297 CDS 100% 15.000 10.500 N Ccdc32 n/a
4 TRCN0000263651 TGAGAGCACCTTGGAACATTT pLKO_005 479 CDS 100% 13.200 9.240 N CCDC32 n/a
5 TRCN0000182138 CGATTCCTCCAGGAGAAGTTA pLKO.1 423 CDS 100% 5.625 3.938 N Ccdc32 n/a
6 TRCN0000176680 CGTTCCAAATTAGACTTGTAA pLKO.1 1317 3UTR 100% 5.625 3.938 N Ccdc32 n/a
7 TRCN0000181827 GAGCACCTTGGAACATTTCAA pLKO.1 482 CDS 100% 5.625 3.938 N Ccdc32 n/a
8 TRCN0000181260 CGGATAGAATGGATCAGTCAA pLKO.1 972 3UTR 100% 4.950 3.465 N Ccdc32 n/a
9 TRCN0000200455 GATGAGAGCACCTTGGAACAT pLKO.1 477 CDS 100% 4.950 3.465 N Ccdc32 n/a
10 TRCN0000181785 GCTTCTGCTTGTAGGAACTTT pLKO.1 1293 3UTR 100% 5.625 3.375 N Ccdc32 n/a
11 TRCN0000167375 GAAGTGTATTTAGCATCTCTA pLKO.1 306 CDS 100% 4.950 2.970 N CCDC32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04516 pDONR223 100% 85.7% 83.2% None (many diffs) n/a
2 ccsbBroad304_04516 pLX_304 0% 85.7% 83.2% V5 (many diffs) n/a
3 TRCN0000470236 GAACGGCCGGACAGTTGTGGCTTT pLX_317 78% 85.7% 83.2% V5 (many diffs) n/a
Download CSV