Transcript: Human NM_199427.2

Homo sapiens ZFP64 zinc finger protein (ZFP64), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ZFP64 (55734)
Length:
2967
CDS:
350..2287

Additional Resources:

NCBI RefSeq record:
NM_199427.2
NBCI Gene record:
ZFP64 (55734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232914 GCTGACTCCCGACATCCATAT pLKO_005 424 CDS 100% 10.800 15.120 N ZFP64 n/a
2 TRCN0000107449 TGCCAATTCAAGACTGCTTAT pLKO.1 800 CDS 100% 10.800 6.480 N ZFP64 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08573 pDONR223 100% 51.1% 47.9% None (many diffs) n/a
2 ccsbBroad304_08573 pLX_304 0% 51.1% 47.9% V5 (many diffs) n/a
3 TRCN0000480194 GTCTGGGTACTACCATCCTTCCCT pLX_317 19.3% 51.1% 47.9% V5 (many diffs) n/a
Download CSV