Transcript: Human NM_201224.2

Homo sapiens DEAD-box helicase 47 (DDX47), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
DDX47 (51202)
Length:
1670
CDS:
23..1243

Additional Resources:

NCBI RefSeq record:
NM_201224.2
NBCI Gene record:
DDX47 (51202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005621 CCTTAATAAGTTTAAGGCCAA pLKO.1 790 CDS 100% 0.216 0.173 N DDX47 n/a
2 TRCN0000005618 CGAGTTCTGCTGTTCTGTAAA pLKO.1 1261 3UTR 100% 13.200 9.240 N DDX47 n/a
3 TRCN0000273576 CGAGTTCTGCTGTTCTGTAAA pLKO_005 1261 3UTR 100% 13.200 9.240 N DDX47 n/a
4 TRCN0000335964 GAAGCGGAAAGGCCGTTAATC pLKO_005 1225 CDS 100% 13.200 9.240 N DDX47 n/a
5 TRCN0000273521 GGCCTTACAAGGTCGTGATAT pLKO_005 193 CDS 100% 13.200 9.240 N DDX47 n/a
6 TRCN0000005620 CCGAATACTGAATATGGATTT pLKO.1 553 CDS 100% 10.800 7.560 N DDX47 n/a
7 TRCN0000273575 CCGAATACTGAATATGGATTT pLKO_005 553 CDS 100% 10.800 7.560 N DDX47 n/a
8 TRCN0000005622 CCCACCAAGATCCAGATTGAA pLKO.1 161 CDS 100% 5.625 3.938 N DDX47 n/a
9 TRCN0000005619 GCTCTGAAGAATCCTGTGAAA pLKO.1 677 CDS 100% 4.950 2.970 N DDX47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11962 pDONR223 100% 60.2% 60.2% None 1_396del;748_749ins147 n/a
2 ccsbBroad304_11962 pLX_304 0% 60.2% 60.2% V5 1_396del;748_749ins147 n/a
3 TRCN0000480789 TTTACCTTCCATGCACGAACGGTA pLX_317 50.4% 60.2% 60.2% V5 1_396del;748_749ins147 n/a
Download CSV