Transcript: Human NM_201262.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member C12 (DNAJC12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
DNAJC12 (56521)
Length:
786
CDS:
169..492

Additional Resources:

NCBI RefSeq record:
NM_201262.1
NBCI Gene record:
DNAJC12 (56521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022318 TGGGATGTGATGAACTATCTT pLKO.1 224 CDS 100% 5.625 4.500 N DNAJC12 n/a
2 TRCN0000273886 TGGGATGTGATGAACTATCTT pLKO_005 224 CDS 100% 5.625 4.500 N DNAJC12 n/a
3 TRCN0000022315 GCAAAGGAGATTCTGACCAAT pLKO.1 352 CDS 100% 4.950 3.465 N DNAJC12 n/a
4 TRCN0000273831 GCAAAGGAGATTCTGACCAAT pLKO_005 352 CDS 100% 4.950 3.465 N DNAJC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201262.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03725 pDONR223 100% 51% 49.7% None (many diffs) n/a
2 TRCN0000474287 TTCAAGCATATGGTAGAACCTCGT pLX_317 75.5% 51% 49.7% V5 (many diffs) n/a
Download CSV