Transcript: Human NM_201269.3

Homo sapiens zinc finger protein 644 (ZNF644), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ZNF644 (84146)
Length:
5541
CDS:
64..4047

Additional Resources:

NCBI RefSeq record:
NM_201269.3
NBCI Gene record:
ZNF644 (84146)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430068 ACAGACTTATTGGACAATTAT pLKO_005 4348 3UTR 100% 15.000 21.000 N ZNF644 n/a
2 TRCN0000145032 GACTGGATTAAGCACTTACAA pLKO.1 3898 CDS 100% 5.625 7.875 N ZNF644 n/a
3 TRCN0000414524 TCTCTACTAATGGCCGAAGCA pLKO_005 4018 CDS 100% 2.640 3.696 N ZNF644 n/a
4 TRCN0000140402 GACGAGGTTTACATTCTCCGA pLKO.1 3829 CDS 100% 0.660 0.924 N ZNF644 n/a
5 TRCN0000121698 CCAGTTTGAATTGGATGTAAA pLKO.1 4070 3UTR 100% 13.200 9.240 N ZNF644 n/a
6 TRCN0000145205 GAAGTCACGTCACTACTTAAA pLKO.1 3967 CDS 100% 13.200 9.240 N ZNF644 n/a
7 TRCN0000436099 TCCATTACAGAAACTTCATTT pLKO_005 3997 CDS 100% 13.200 9.240 N ZNF644 n/a
8 TRCN0000140261 GTGCTGACGAGGTTTACATTC pLKO.1 3824 CDS 100% 10.800 7.560 N ZNF644 n/a
9 TRCN0000412911 ATGCTAACATTACCTCATGGT pLKO_005 3805 CDS 100% 2.640 1.848 N ZNF644 n/a
10 TRCN0000140054 CAAGGTCAAGATCTGGAAGCA pLKO.1 3776 CDS 100% 2.640 1.848 N ZNF644 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201269.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09151 pDONR223 100% 99.9% 99.9% None 2008C>A n/a
2 ccsbBroad304_09151 pLX_304 0% 99.9% 99.9% V5 2008C>A n/a
3 TRCN0000475663 TTTATGCATGAGACAATACTCATG pLX_317 7.9% 99.9% 99.9% V5 2008C>A n/a
Download CSV