Transcript: Human NM_201382.4

Homo sapiens plectin (PLEC), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PLEC (5339)
Length:
14763
CDS:
96..13739

Additional Resources:

NCBI RefSeq record:
NM_201382.4
NBCI Gene record:
PLEC (5339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201382.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082815 CGTAGGAAATACAGTTGTGAT pLKO.1 2331 CDS 100% 4.950 6.930 N PLEC n/a
2 TRCN0000315767 CGTAGGAAATACAGTTGTGAT pLKO_005 2331 CDS 100% 4.950 6.930 N PLEC n/a
3 TRCN0000082817 CCTCTTCGATGAGGAGATGAA pLKO.1 12305 CDS 100% 4.950 3.465 N PLEC n/a
4 TRCN0000315766 CCTCTTCGATGAGGAGATGAA pLKO_005 12305 CDS 100% 4.950 3.465 N PLEC n/a
5 TRCN0000082816 CGATGAGGAGATGAACGAGAT pLKO.1 12311 CDS 100% 4.050 2.835 N PLEC n/a
6 TRCN0000082813 GCCTTCCATGTCGGCCTCTAA pLKO.1 14343 3UTR 100% 1.650 1.155 N PLEC n/a
7 TRCN0000315848 GCCTTCCATGTCGGCCTCTAA pLKO_005 14343 3UTR 100% 1.650 1.155 N PLEC n/a
8 TRCN0000082814 GCACCAGTCCATCGAAGAATT pLKO.1 1778 CDS 100% 0.000 0.000 N PLEC n/a
9 TRCN0000315845 GCACCAGTCCATCGAAGAATT pLKO_005 1778 CDS 100% 0.000 0.000 N PLEC n/a
10 TRCN0000435117 CATCGCTGGTGTCTTCGTGTA pLKO_005 11897 CDS 100% 4.050 2.430 N Aqp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201382.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.