Transcript: Mouse NM_201411.2

Mus musculus fibronectin leucine rich transmembrane protein 1 (Flrt1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Flrt1 (396184)
Length:
5876
CDS:
693..2717

Additional Resources:

NCBI RefSeq record:
NM_201411.2
NBCI Gene record:
Flrt1 (396184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113560 GCACCGGTGTGTCACGTGGCT pLKO.1 2740 3UTR 100% 0.000 0.000 N Flrt1 n/a
2 TRCN0000113563 CCCAGACTCCAACATTGACTA pLKO.1 1955 CDS 100% 4.950 3.960 N Flrt1 n/a
3 TRCN0000113562 CCTACAGAACAACCAGATCAA pLKO.1 953 CDS 100% 4.950 3.465 N Flrt1 n/a
4 TRCN0000113564 GTTTCTCTGTTATGGGCTCAT pLKO.1 797 CDS 100% 4.050 2.835 N Flrt1 n/a
5 TRCN0000113561 GCACACCATATTTCCCTCCAA pLKO.1 2597 CDS 100% 2.640 1.848 N Flrt1 n/a
6 TRCN0000156637 GACAACAATGTGCGCACCATT pLKO.1 1098 CDS 100% 4.950 3.465 N FLRT1 n/a
7 TRCN0000157633 CTGTTTACCCTCAAGGCCAAA pLKO.1 1917 CDS 100% 4.050 2.835 N FLRT1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3944 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07931 pDONR223 100% 89.2% 96.1% None (many diffs) n/a
2 ccsbBroad304_07931 pLX_304 0% 89.2% 96.1% V5 (many diffs) n/a
3 TRCN0000481508 TCCGAAAGAGCCTGGATGACGTTG pLX_317 23.7% 89.2% 96.1% V5 (many diffs) n/a
Download CSV