Transcript: Human NM_201553.1

Homo sapiens fibrinogen like 1 (FGL1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
FGL1 (2267)
Length:
1500
CDS:
325..1263

Additional Resources:

NCBI RefSeq record:
NM_201553.1
NBCI Gene record:
FGL1 (2267)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151181 GAAGTCCAGTTCCTTGATAAA pLKO.1 499 CDS 100% 13.200 18.480 N FGL1 n/a
2 TRCN0000319090 GAAGTCCAGTTCCTTGATAAA pLKO_005 499 CDS 100% 13.200 18.480 N FGL1 n/a
3 TRCN0000150808 GCCGTTATGCACAATATAAGA pLKO.1 872 CDS 100% 5.625 7.875 N FGL1 n/a
4 TRCN0000156822 GTGGGCTAGTCACCAAAGAAT pLKO.1 999 CDS 100% 5.625 4.500 N FGL1 n/a
5 TRCN0000151020 GACAGAGATCATGACAACTAT pLKO.1 1036 CDS 100% 5.625 3.938 N FGL1 n/a
6 TRCN0000151295 GCTAGTCACCAAAGAATGAAA pLKO.1 1003 CDS 100% 5.625 3.938 N FGL1 n/a
7 TRCN0000319020 GCTAGTCACCAAAGAATGAAA pLKO_005 1003 CDS 100% 5.625 3.938 N FGL1 n/a
8 TRCN0000150328 CCTTGATAAAGGAGATGAGAA pLKO.1 510 CDS 100% 4.950 3.465 N FGL1 n/a
9 TRCN0000157414 GACGATCTGATGGCAGTGAAA pLKO.1 698 CDS 100% 4.950 3.465 N FGL1 n/a
10 TRCN0000319091 GACGATCTGATGGCAGTGAAA pLKO_005 698 CDS 100% 4.950 3.465 N FGL1 n/a
11 TRCN0000089520 GTATGCAGATTGTTCAGAGAT pLKO.1 561 CDS 100% 4.950 3.465 N Fgl1 n/a
12 TRCN0000325609 GTATGCAGATTGTTCAGAGAT pLKO_005 561 CDS 100% 4.950 3.465 N Fgl1 n/a
13 TRCN0000153532 CTGAACATATCCATGCGCAAT pLKO.1 1330 3UTR 100% 4.050 2.835 N FGL1 n/a
14 TRCN0000319021 CTGAACATATCCATGCGCAAT pLKO_005 1330 3UTR 100% 4.050 2.835 N FGL1 n/a
15 TRCN0000152965 GAGAATGAAGTCCAGTTCCTT pLKO.1 493 CDS 100% 3.000 2.100 N FGL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06212 pDONR223 100% 99.8% 100% None 42G>T n/a
2 ccsbBroad304_06212 pLX_304 0% 99.8% 100% V5 42G>T n/a
3 TRCN0000467977 GACATCATACTCCAATGCCCTACG pLX_317 38.4% 99.8% 100% V5 42G>T n/a
Download CSV