Transcript: Human NM_201631.4

Homo sapiens transglutaminase 5 (TGM5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TGM5 (9333)
Length:
2843
CDS:
80..2242

Additional Resources:

NCBI RefSeq record:
NM_201631.4
NBCI Gene record:
TGM5 (9333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056251 CCAGTACCTGTCAACAGACAA pLKO.1 1834 CDS 100% 4.950 3.960 N TGM5 n/a
2 TRCN0000426215 TATCCAAGCATCACGATTAAT pLKO_005 1934 CDS 100% 15.000 10.500 N TGM5 n/a
3 TRCN0000056250 CAATGGAAACTGGAGTGAGAA pLKO.1 793 CDS 100% 4.950 3.465 N TGM5 n/a
4 TRCN0000056248 CCACTCTCCATACAGGTGATA pLKO.1 1982 CDS 100% 4.950 3.465 N TGM5 n/a
5 TRCN0000056252 CCCTGGAACTATGGACAGTTT pLKO.1 617 CDS 100% 4.950 3.465 N TGM5 n/a
6 TRCN0000056249 CTGAACTATGACACGCCCTTT pLKO.1 1241 CDS 100% 4.050 2.835 N TGM5 n/a
7 TRCN0000413360 TATGCTAGGCACTCAACAAAT pLKO_005 2478 3UTR 100% 13.200 7.920 N TGM5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201631.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02141 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02141 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477164 ACGAGTGTGTCCAGGAGGCTTATC pLX_317 16.2% 100% 100% V5 n/a
4 ccsbBroadEn_07392 pDONR223 100% 99.9% 99.8% None 326C>A;951T>C n/a
5 ccsbBroad304_07392 pLX_304 0% 99.9% 99.8% V5 326C>A;951T>C n/a
6 TRCN0000477414 GCTGTCCCCGGGACTGGGAACTTT pLX_317 19.9% 99.9% 99.8% V5 326C>A;951T>C n/a
Download CSV