Transcript: Human NM_201651.3

Homo sapiens solute carrier family 28 member 1 (SLC28A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-19
Taxon:
Homo sapiens (human)
Gene:
SLC28A1 (9154)
Length:
1352
CDS:
223..750

Additional Resources:

NCBI RefSeq record:
NM_201651.3
NBCI Gene record:
SLC28A1 (9154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07368 pDONR223 100% 26.2% 23.8% None (many diffs) n/a
2 ccsbBroad304_07368 pLX_304 0% 26.2% 23.8% V5 (many diffs) n/a
3 TRCN0000469767 GCTGGTTTTTTTGTTTTAACAGAT pLX_317 20.4% 26.2% 23.8% V5 (many diffs) n/a
4 TRCN0000488389 TAACTGTGGTCTTTGATTAAGTCC pLX_317 14.6% 26.2% 23.8% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491748 ATTATGCAAACGGGTAGTGATCTT pLX_317 14.6% 26.2% 23.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV