Transcript: Human NM_202000.2

Homo sapiens acyl-CoA synthetase medium chain family member 3 (ACSM3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
ACSM3 (6296)
Length:
1587
CDS:
188..1504

Additional Resources:

NCBI RefSeq record:
NM_202000.2
NBCI Gene record:
ACSM3 (6296)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_202000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419964 CAAAGAGGAGATCGGGTAATT pLKO_005 539 CDS 100% 13.200 10.560 N ACSM3 n/a
2 TRCN0000420216 CAGACTGAAACGGTGCTAATC pLKO_005 1319 CDS 100% 10.800 8.640 N ACSM3 n/a
3 TRCN0000083241 CCTGGACCAATGGACTGATAA pLKO.1 379 CDS 100% 13.200 9.240 N ACSM3 n/a
4 TRCN0000083238 GCTGGAAAGAAACCTTCAAAT pLKO.1 407 CDS 100% 13.200 9.240 N ACSM3 n/a
5 TRCN0000083240 CCCTCAGATGTGATGTGGAAT pLKO.1 989 CDS 100% 4.950 3.465 N ACSM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_202000.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11116 pDONR223 100% 98.1% 98.1% None 1_24del n/a
2 ccsbBroad304_11116 pLX_304 0% 98.1% 98.1% V5 1_24del n/a
3 TRCN0000492316 CCACTCTCCTATCCTCATCATTTA pLX_317 23.6% 98.1% 98.1% V5 1_24del n/a
Download CSV