Transcript: Human NM_202470.3

Homo sapiens GIPC PDZ domain containing family member 1 (GIPC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
GIPC1 (10755)
Length:
1777
CDS:
122..1123

Additional Resources:

NCBI RefSeq record:
NM_202470.3
NBCI Gene record:
GIPC1 (10755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_202470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036769 GCAAATGCAATAATGCCCTCA pLKO.1 1550 3UTR 100% 2.160 3.024 N GIPC1 n/a
2 TRCN0000289267 GCAAATGCAATAATGCCCTCA pLKO_005 1550 3UTR 100% 2.160 3.024 N GIPC1 n/a
3 TRCN0000036773 CGACATGATCGAGGCCATTAA pLKO.1 646 CDS 100% 13.200 9.240 N GIPC1 n/a
4 TRCN0000289268 CGACATGATCGAGGCCATTAA pLKO_005 646 CDS 100% 13.200 9.240 N GIPC1 n/a
5 TRCN0000036772 ACCAACGTCAAGGAGCTGTAT pLKO.1 350 CDS 100% 4.950 3.465 N GIPC1 n/a
6 TRCN0000289266 ACCAACGTCAAGGAGCTGTAT pLKO_005 350 CDS 100% 4.950 3.465 N GIPC1 n/a
7 TRCN0000036770 GCTGGAGAGTTACATGGGTAT pLKO.1 934 CDS 100% 4.050 2.835 N GIPC1 n/a
8 TRCN0000307057 GCTGGAGAGTTACATGGGTAT pLKO_005 934 CDS 100% 4.050 2.835 N GIPC1 n/a
9 TRCN0000036771 GCCTTTGAAGAGAAGGCCATT pLKO.1 896 CDS 100% 0.405 0.243 N GIPC1 n/a
10 TRCN0000289265 GCCTTTGAAGAGAAGGCCATT pLKO_005 896 CDS 100% 0.405 0.243 N GIPC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_202470.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.