Transcript: Human NM_203290.4

Homo sapiens RNA polymerase I and III subunit C (POLR1C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
POLR1C (9533)
Length:
1275
CDS:
22..1062

Additional Resources:

NCBI RefSeq record:
NM_203290.4
NBCI Gene record:
POLR1C (9533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052903 CCCGGTAACTATTCCGGTTAT pLKO.1 109 CDS 100% 10.800 15.120 N POLR1C n/a
2 TRCN0000308012 CTAGCTGAGGTGCCAACTATG pLKO_005 262 CDS 100% 10.800 15.120 N POLR1C n/a
3 TRCN0000052906 GAGTTTGACATGGTGGGAATT pLKO.1 205 CDS 100% 0.000 0.000 N POLR1C n/a
4 TRCN0000298808 GAGTTTGACATGGTGGGAATT pLKO_005 205 CDS 100% 0.000 0.000 N POLR1C n/a
5 TRCN0000295964 GTGCTTCTCACCTGGTGTTAT pLKO_005 786 CDS 100% 13.200 10.560 N POLR1C n/a
6 TRCN0000052905 CCCGGGTTCGAGATCATTATA pLKO.1 920 CDS 100% 15.000 10.500 N POLR1C n/a
7 TRCN0000308009 AGAAGGTCCTGGTGTACAATA pLKO_005 290 CDS 100% 13.200 9.240 N POLR1C n/a
8 TRCN0000295965 CCGACCAGTGCATGATGATAT pLKO_005 591 CDS 100% 13.200 9.240 N POLR1C n/a
9 TRCN0000052904 CCAAGAAATTGACCTGCTCAT pLKO.1 636 CDS 100% 4.050 2.835 N POLR1C n/a
10 TRCN0000052907 CGAACTGTACGTGAACCACAA pLKO.1 501 CDS 100% 4.050 2.835 N POLR1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203290.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02187 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02187 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468789 TTTTGCCTGCGACTATCTATACCC pLX_317 46.1% 100% 100% V5 n/a
Download CSV