Transcript: Human NM_203382.3

Homo sapiens alpha-methylacyl-CoA racemase (AMACR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
AMACR (23600)
Length:
3947
CDS:
32..628

Additional Resources:

NCBI RefSeq record:
NM_203382.3
NBCI Gene record:
AMACR (23600)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203382.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431801 ACTTTGGGTACTTATACTAAA pLKO_005 1219 3UTR 100% 13.200 6.600 Y AMACR n/a
2 TRCN0000084113 CCACAAATTGTATGGTGATAA pLKO.1 1408 3UTR 100% 13.200 6.600 Y AMACR n/a
3 TRCN0000084116 CGAAGAGATTTATCAGCTTAA pLKO.1 953 3UTR 100% 10.800 5.400 Y AMACR n/a
4 TRCN0000422956 GCACCTTTCTATACGACTTAC pLKO_005 519 CDS 100% 10.800 5.400 Y AMACR n/a
5 TRCN0000419430 GTAGAGTAACACATAACATTG pLKO_005 1066 3UTR 100% 10.800 5.400 Y AMACR n/a
6 TRCN0000084114 CTGAGGAGATACTTGAAGAAT pLKO.1 919 3UTR 100% 5.625 2.813 Y AMACR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203382.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07914 pDONR223 100% 99.6% 99.4% None 25G>A;441T>C n/a
2 ccsbBroad304_07914 pLX_304 0% 99.6% 99.4% V5 25G>A;441T>C n/a
3 TRCN0000480210 ATAATCTTTCTGTGCCAGACATGT pLX_317 66.6% 99.6% 99.4% V5 25G>A;441T>C n/a
Download CSV