Transcript: Mouse NM_203507.3

Mus musculus RWD domain containing 4A (Rwdd4a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rwdd4a (192174)
Length:
2971
CDS:
276..842

Additional Resources:

NCBI RefSeq record:
NM_203507.3
NBCI Gene record:
Rwdd4a (192174)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_203507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248601 AGTACGCTAAGGACCATAAAG pLKO_005 580 CDS 100% 13.200 18.480 N Rwdd4a n/a
2 TRCN0000248598 CTAGAAGCTTTACGGTCTATT pLKO_005 306 CDS 100% 13.200 18.480 N Rwdd4a n/a
3 TRCN0000248600 GATAACAGTTTCCGGGAATTA pLKO_005 336 CDS 100% 13.200 18.480 N Rwdd4a n/a
4 TRCN0000248599 ATTCCTCGAACGACCCGTAAT pLKO_005 1225 3UTR 100% 10.800 15.120 N Rwdd4a n/a
5 TRCN0000248597 TTGACGTCGTGAAGCATTTAA pLKO_005 793 CDS 100% 15.000 10.500 N Rwdd4a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203507.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05202 pDONR223 100% 85.6% 90.9% None (many diffs) n/a
2 ccsbBroad304_05202 pLX_304 0% 85.6% 90.9% V5 (many diffs) n/a
3 TRCN0000465433 TACAGATGCCATTAACTCAATACA pLX_317 51.1% 85.6% 90.9% V5 (many diffs) n/a
Download CSV