Transcript: Human NM_206914.2

Homo sapiens EEF1A lysine methyltransferase 3 (EEF1AKMT3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
EEF1AKMT3 (25895)
Length:
2826
CDS:
112..561

Additional Resources:

NCBI RefSeq record:
NM_206914.2
NBCI Gene record:
EEF1AKMT3 (25895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139297 CAGACTCTTACTCGGAGAAGA pLKO.1 182 CDS 100% 4.950 3.465 N EEF1AKMT3 n/a
2 TRCN0000140524 GCCACAAACATGAGGACCAAA pLKO.1 1006 3UTR 100% 4.950 3.465 N EEF1AKMT3 n/a
3 TRCN0000122880 GCTGTGGTTTACTCCTGTCTA pLKO.1 2578 3UTR 100% 4.950 3.465 N EEF1AKMT3 n/a
4 TRCN0000122481 CGAGGCAAGAAGGTGATCGAA pLKO.1 334 CDS 100% 3.000 2.100 N EEF1AKMT3 n/a
5 TRCN0000140905 CTTTGCAGACTCTTACTCGGA pLKO.1 177 CDS 100% 0.660 0.462 N EEF1AKMT3 n/a
6 TRCN0000138969 CAGTTCTGTTTCTGTGGGCAT pLKO.1 205 CDS 100% 2.160 1.296 N EEF1AKMT3 n/a
7 TRCN0000139528 CTCCAAGATGAGAAAGGAGCA pLKO.1 787 3UTR 100% 2.160 1.296 N EEF1AKMT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07958 pDONR223 100% 55.9% 43.4% None (many diffs) n/a
2 ccsbBroad304_07958 pLX_304 0% 55.9% 43.4% V5 (many diffs) n/a
Download CSV