Transcript: Mouse NM_206973.2

Mus musculus G protein-coupled receptor 152 (Gpr152), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gpr152 (269053)
Length:
3939
CDS:
646..2181

Additional Resources:

NCBI RefSeq record:
NM_206973.2
NBCI Gene record:
Gpr152 (269053)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_206973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220745 CCACCGTTGGATACTGTAGTT pLKO.1 1816 CDS 100% 4.950 6.930 N Gpr152 n/a
2 TRCN0000220748 CAACATCTGAAGGCCAGTCAA pLKO.1 1655 CDS 100% 4.950 3.960 N Gpr152 n/a
3 TRCN0000220746 GCTGCTCTATCTGGCTTTCTT pLKO.1 1419 CDS 100% 5.625 3.938 N Gpr152 n/a
4 TRCN0000220749 CCACTGCTTGTAGGACCTGTT pLKO.1 1295 CDS 100% 4.050 2.835 N Gpr152 n/a
5 TRCN0000220747 GCAACTTTCCAAATCCTGGAA pLKO.1 895 CDS 100% 0.264 0.185 N Gpr152 n/a
6 TRCN0000063563 GCCGCTTCTACTACTTCCTAT pLKO.1 956 CDS 100% 4.950 3.465 N GPR152 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.