Transcript: Human NM_207336.3

Homo sapiens zinc finger protein 467 (ZNF467), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ZNF467 (168544)
Length:
2843
CDS:
524..2311

Additional Resources:

NCBI RefSeq record:
NM_207336.3
NBCI Gene record:
ZNF467 (168544)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107932 CGCAAGAAGACGCACTTGATT pLKO.1 1367 CDS 100% 5.625 4.500 N ZNF467 n/a
2 TRCN0000107931 GCTGTCAGTCTGTCAGTCTTT pLKO.1 346 5UTR 100% 4.950 3.960 N ZNF467 n/a
3 TRCN0000107930 ACCCTTTCTTGCCCACAGTTT pLKO.1 2329 3UTR 100% 4.950 3.465 N ZNF467 n/a
4 TRCN0000107933 TCGCAAGAAGACGCACTTGAT pLKO.1 1366 CDS 100% 4.950 3.465 N ZNF467 n/a
5 TRCN0000107934 GTGGATGATTCGGAAGGTGAA pLKO.1 793 CDS 100% 4.050 2.835 N ZNF467 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207336.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05144 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05144 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477927 GAGGTTATGTATTCTAGGAGATGG pLX_317 13.7% 100% 100% V5 n/a
Download CSV