Transcript: Mouse NM_207525.3

Mus musculus optic atrophy 3 (Opa3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Opa3 (403187)
Length:
2260
CDS:
55..594

Additional Resources:

NCBI RefSeq record:
NM_207525.3
NBCI Gene record:
Opa3 (403187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250166 CCAGACTCAGCAGCGCAATAA pLKO_005 366 CDS 100% 13.200 10.560 N Opa3 n/a
2 TRCN0000184236 GCGAGTTCTTCAAGACCTACA pLKO.1 155 CDS 100% 4.050 3.240 N Opa3 n/a
3 TRCN0000216100 CCATATTGAAAGAGCCTTTAT pLKO.1 1601 3UTR 100% 13.200 9.240 N Opa3 n/a
4 TRCN0000250168 GCGGACGAAGATGCGCATAAT pLKO_005 216 CDS 100% 13.200 9.240 N Opa3 n/a
5 TRCN0000184386 GCAATGCTCACTGTACTTCCA pLKO.1 545 CDS 100% 2.640 1.848 N Opa3 n/a
6 TRCN0000250165 TACAAGACCCACCCTAAATTT pLKO_005 1573 3UTR 100% 15.000 9.000 N Opa3 n/a
7 TRCN0000250164 CTACCATCAAGCCACTGAATG pLKO_005 251 CDS 100% 10.800 6.480 N Opa3 n/a
8 TRCN0000250167 GAGTTCTTCAAGACCTACATC pLKO_005 157 CDS 100% 4.950 2.970 N Opa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09013 pDONR223 98.3% 82.4% 85.4% None (many diffs) n/a
2 ccsbBroad304_09013 pLX_304 0% 82.4% 85.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV