Transcript: Mouse NM_207535.1

Mus musculus MAS-related GPR, member A7 (Mrgpra7), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrgpra7 (404236)
Length:
918
CDS:
1..918

Additional Resources:

NCBI RefSeq record:
NM_207535.1
NBCI Gene record:
Mrgpra7 (404236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_207535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193847 CAACTTCTTTATGGGAGCATA pLKO.1 498 CDS 100% 4.950 3.465 N Mrgpra7 n/a
2 TRCN0000194431 CCCAACGGTATCTTTGTCTAT pLKO.1 235 CDS 100% 4.950 3.465 N Mrgpra7 n/a
3 TRCN0000173763 CGTGTTGATCTGCATTCTGAA pLKO.1 417 CDS 100% 4.950 2.970 N Mrgpra7 n/a
4 TRCN0000240442 CTTCTTAGTCTACATCCTAAA pLKO_005 138 CDS 100% 10.800 5.400 Y Gm2707 n/a
5 TRCN0000175471 CAGATTATTCGTGACCATCAT pLKO.1 606 CDS 100% 4.950 2.475 Y Mrgpra7 n/a
6 TRCN0000176061 GATCCCAAACTTGATGATCAT pLKO.1 42 CDS 100% 4.950 2.475 Y Mrgpra4 n/a
7 TRCN0000245412 GGCTGACAGGAAATGCCATTT pLKO_005 80 CDS 100% 10.800 5.400 Y Gm2707 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.