Transcript: Human NM_212482.3

Homo sapiens fibronectin 1 (FN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
FN1 (2335)
Length:
8804
CDS:
267..7700

Additional Resources:

NCBI RefSeq record:
NM_212482.3
NBCI Gene record:
FN1 (2335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_212482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293790 TGGAACCGGGAACCGAATATA pLKO_005 6427 CDS 100% 15.000 21.000 N FN1 n/a
2 TRCN0000064829 CGGTTGTTATGACAATGGAAA pLKO.1 416 CDS 100% 4.950 6.930 N FN1 n/a
3 TRCN0000064828 CGTGGTTGTATCAGGACTTAT pLKO.1 5867 CDS 100% 13.200 10.560 N FN1 n/a
4 TRCN0000286357 CGTGGTTGTATCAGGACTTAT pLKO_005 5867 CDS 100% 13.200 10.560 N FN1 n/a
5 TRCN0000293839 TGCAGCACAACTTCGAATTAT pLKO_005 1422 CDS 100% 15.000 10.500 N FN1 n/a
6 TRCN0000293840 AGATTTGGTTTGGGATCAATA pLKO_005 7970 3UTR 100% 13.200 9.240 N FN1 n/a
7 TRCN0000064830 CCCTACACAGTTTCCCATTAT pLKO.1 7164 CDS 100% 13.200 9.240 N FN1 n/a
8 TRCN0000090370 GCTAAACTCTTCCACCATTAT pLKO.1 4133 CDS 100% 13.200 9.240 N Fn1 n/a
9 TRCN0000064832 GCCTGCTCCAAGAATTGGTTT pLKO.1 3590 CDS 100% 4.950 3.465 N FN1 n/a
10 TRCN0000286356 GCCTGCTCCAAGAATTGGTTT pLKO_005 3590 CDS 100% 4.950 3.465 N FN1 n/a
11 TRCN0000064831 CCACTTAAACTCCTACACCAT pLKO.1 2249 CDS 100% 2.640 1.848 N FN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_212482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471752 ACGCAATGCTAACAACCAAAGATG pLX_317 5.9% 87.7% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV