Transcript: Human NM_213568.2

Homo sapiens solute carrier family 39 member 3 (SLC39A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
SLC39A3 (29985)
Length:
2986
CDS:
255..572

Additional Resources:

NCBI RefSeq record:
NM_213568.2
NBCI Gene record:
SLC39A3 (29985)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417550 GAGAAGGCCCATCGCTCGAAA pLKO_005 357 CDS 100% 1.650 2.310 N SLC39A3 n/a
2 TRCN0000038539 GTGAAGATCATCGAGACAGAT pLKO.1 333 CDS 100% 4.950 3.465 N SLC39A3 n/a
3 TRCN0000414209 TGTTTCTGGCCACGTGCTTCA pLKO_005 415 CDS 100% 4.050 2.835 N SLC39A3 n/a
4 TRCN0000038543 CCTCTCTCTCTGCAACACCTT pLKO.1 383 CDS 100% 2.640 1.848 N SLC39A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03123 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03123 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478525 TTTACGTAGTGTCCCCCGATCCGA pLX_317 100% 100% 100% V5 n/a
Download CSV