Transcript: Human NM_213602.3

Homo sapiens sialic acid binding Ig like lectin 15 (SIGLEC15), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
SIGLEC15 (284266)
Length:
2948
CDS:
55..1041

Additional Resources:

NCBI RefSeq record:
NM_213602.3
NBCI Gene record:
SIGLEC15 (284266)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119197 CCATATACTATTGGTGGGAAT pLKO.1 2373 3UTR 100% 4.050 5.670 N SIGLEC15 n/a
2 TRCN0000431577 TTCTCCCGACAGGCTCATTTG pLKO_005 95 CDS 100% 10.800 8.640 N SIGLEC15 n/a
3 TRCN0000281449 GATCGTCAACATCTCGGTGCT pLKO_005 561 CDS 100% 2.160 1.728 N Siglec15 n/a
4 TRCN0000426790 GATCGTCAACATCTCGGTGCT pLKO_005 561 CDS 100% 2.160 1.728 N SIGLEC15 n/a
5 TRCN0000415399 CTCCTATGTGGACAACCATTT pLKO_005 1209 3UTR 100% 10.800 7.560 N SIGLEC15 n/a
6 TRCN0000119201 GTCTACCTGTTCCGCTTCCAT pLKO.1 802 CDS 100% 3.000 2.100 N SIGLEC15 n/a
7 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2509 3UTR 100% 4.050 2.025 Y P3H4 n/a
8 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2509 3UTR 100% 4.050 2.025 Y ORAI2 n/a
9 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2509 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.