Transcript: Human NM_213608.2

Homo sapiens chromosome 2 open reading frame 66 (C2orf66), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
C2orf66 (401027)
Length:
2259
CDS:
890..1243

Additional Resources:

NCBI RefSeq record:
NM_213608.2
NBCI Gene record:
C2orf66 (401027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373927 CTCTTTCCAGTCAGAACTTAC pLKO_005 1159 CDS 100% 10.800 8.640 N C2orf66 n/a
2 TRCN0000148444 CAGAAGGCTTCAGGCATATTT pLKO.1 1069 CDS 100% 15.000 10.500 N C2orf66 n/a
3 TRCN0000373845 AGCACCTCTCCTGCTACTATG pLKO_005 949 CDS 100% 10.800 7.560 N C2orf66 n/a
4 TRCN0000149313 GAATGGAGCCACAGTAAGAAA pLKO.1 997 CDS 100% 5.625 3.938 N C2orf66 n/a
5 TRCN0000148952 CAAATGGAAGCCACTCAACAA pLKO.1 1024 CDS 100% 4.950 3.465 N C2orf66 n/a
6 TRCN0000147393 GCAGATTATGAAGAGCAGAAA pLKO.1 1193 CDS 100% 4.950 3.465 N C2orf66 n/a
7 TRCN0000148558 CAGAACTTACTGCTTCTGCAT pLKO.1 1170 CDS 100% 0.264 0.185 N C2orf66 n/a
8 TRCN0000373846 AGGGCAGAGGTCTTGATCTTG pLKO_005 1092 CDS 100% 4.950 2.970 N C2orf66 n/a
9 TRCN0000148776 CCCAGAAACAGAGATCTGTTT pLKO.1 1046 CDS 100% 0.495 0.297 N C2orf66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05641 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05641 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476254 AAGGTCCTGATTCGCTAAACGTGC pLX_317 90.9% 100% 100% V5 n/a
Download CSV