Transcript: Human NM_213609.4

Homo sapiens TAFA chemokine like family member 1 (TAFA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TAFA1 (407738)
Length:
1979
CDS:
460..861

Additional Resources:

NCBI RefSeq record:
NM_213609.4
NBCI Gene record:
TAFA1 (407738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_213609.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168845 CCAGATAATCACAGTGCGTTT pLKO.1 980 3UTR 100% 4.050 5.670 N TAFA1 n/a
2 TRCN0000166897 CCTACATGAATAAGTCCTGTA pLKO.1 1691 3UTR 100% 4.050 3.240 N TAFA1 n/a
3 TRCN0000172421 CACTCCCTGACAATTCTGGAT pLKO.1 785 CDS 100% 2.640 1.848 N TAFA1 n/a
4 TRCN0000172965 GAACAACAAGAAACCGGCCTT pLKO.1 686 CDS 100% 2.160 1.512 N TAFA1 n/a
5 TRCN0000168747 GAAGAATGTAAGACACTCCCT pLKO.1 772 CDS 100% 0.660 0.462 N TAFA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_213609.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05659 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05659 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477047 TTTTCGCTTCACATCCCCTAGCAG pLX_317 91.1% 100% 100% V5 n/a
Download CSV