Transcript: Human NR_002925.2

Homo sapiens flavin containing dimethylaniline monoxygenase 9, pseudogene (FMO9P), non-coding RNA.

Source:
NCBI, updated 2019-04-26
Taxon:
Homo sapiens (human)
Gene:
FMO9P (116123)
Length:
1390
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002925.2
NBCI Gene record:
FMO9P (116123)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064496 GTTATTTCCATAGTCGGGAAT pLKO.1 685 3UTR 100% 4.050 5.670 N FMO9P n/a
2 TRCN0000064493 GCTATGTCAATGTCCAGGGAA pLKO.1 1114 3UTR 100% 2.640 3.696 N FMO9P n/a
3 TRCN0000064497 CCAGTAGGAACTGAGATTCAA pLKO.1 813 3UTR 100% 5.625 4.500 N FMO9P n/a
4 TRCN0000064494 GCCTCCTGAATTACATTCGTT pLKO.1 475 3UTR 100% 3.000 2.400 N FMO9P n/a
5 TRCN0000064495 CCAGGCATTGAGAAATTTGAA pLKO.1 660 3UTR 100% 5.625 3.375 N FMO9P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10538 pDONR223 100% 34.3% None 1_329del;803A>G;809_1390delinsA n/a
2 ccsbBroad304_10538 pLX_304 0% 34.3% V5 1_329del;803A>G;809_1390delinsA n/a
3 TRCN0000469621 CTCTTTTGCTCGAACTACCCCATT pLX_317 68.6% 34.3% V5 1_329del;803A>G;809_1390delinsA n/a
Download CSV