Transcript: Human NR_003144.1

Homo sapiens acidic nuclear phosphoprotein 32 family member A pseudogene 1 (ANP32AP1), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
ANP32AP1 (723972)
Length:
738
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003144.1
NBCI Gene record:
ANP32AP1 (723972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006904 CCCTCTGATGTGAAAGAACTT pLKO.1 46 3UTR 100% 4.950 2.475 Y ANP32A n/a
2 TRCN0000280013 CCCTCTGATGTGAAAGAACTT pLKO_005 46 3UTR 100% 4.950 2.475 Y ANP32A n/a
3 TRCN0000006905 CCTGAAGATGAGGGAGAAGAT pLKO.1 709 3UTR 100% 4.950 2.475 Y ANP32A n/a
4 TRCN0000280101 CCTGAAGATGAGGGAGAAGAT pLKO_005 709 3UTR 100% 4.950 2.475 Y ANP32A n/a
5 TRCN0000006906 AGAAGCTTGAACTAAGCGATA pLKO.1 200 3UTR 100% 4.050 2.025 Y ANP32A n/a
6 TRCN0000141940 GAAGGCCTCACAGATGAATTT pLKO.1 103 3UTR 100% 13.200 6.600 Y ANP32D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11255 pDONR223 100% 90.1% None (many diffs) n/a
2 ccsbBroad304_11255 pLX_304 0% 90.1% V5 (many diffs) n/a
Download CSV