Transcript: Human NR_003187.3

Homo sapiens neutrophil cytosolic factor 1C pseudogene (NCF1C), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
NCF1C (654817)
Length:
1459
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003187.3
NBCI Gene record:
NCF1C (654817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256332 TGTACATGTTCCTGGTGAAAT pLKO_005 127 3UTR 100% 13.200 6.600 Y NCF1 n/a
2 TRCN0000256334 GGTGGTTCTGTCAGATGAAAG pLKO_005 631 3UTR 100% 10.800 5.400 Y NCF1 n/a
3 TRCN0000256335 GTGAAGCTGTTGAGGTCATTC pLKO_005 802 3UTR 100% 10.800 5.400 Y NCF1 n/a
4 TRCN0000256333 AGGGCACACTTACCGAGTACT pLKO_005 325 3UTR 100% 4.950 2.475 Y NCF1 n/a
5 TRCN0000038928 CAATCCAGAGAACAGGATCAT pLKO.1 248 3UTR 100% 4.950 2.475 Y NCF1C n/a
6 TRCN0000038925 CCGAGATCTACGAGTTCCATA pLKO.1 187 3UTR 100% 4.950 2.475 Y NCF1C n/a
7 TRCN0000038926 GTTCTGTCAGATGAAAGCAAA pLKO.1 635 3UTR 100% 4.950 2.475 Y NCF1C n/a
8 TRCN0000038924 GAGACATACTTGATGCCCAAA pLKO.1 462 3UTR 100% 4.050 2.025 Y NCF1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10190 pDONR223 100% 79.4% None (many diffs) n/a
2 ccsbBroad304_10190 pLX_304 0% 79.4% V5 (many diffs) n/a
3 TRCN0000470820 CGGCCAATTTTGTTAATTTGTTAC pLX_317 1.6% 79.4% V5 (many diffs) n/a
Download CSV