Transcript: Human NR_003272.4

Homo sapiens paraspeckle component 1 (PSPC1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PSPC1 (55269)
Length:
1679
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003272.4
NBCI Gene record:
PSPC1 (55269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003272.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338618 TAGGCATGAACACCAATTAAT pLKO_005 1121 3UTR 100% 15.000 21.000 N PSPC1 n/a
2 TRCN0000295149 GCTAATGAGGCAAGATCTAAT pLKO_005 1142 3UTR 100% 13.200 18.480 N Pspc1 n/a
3 TRCN0000156144 CGTGAGGAAGAAATGATCCGA pLKO.1 1263 3UTR 100% 0.750 1.050 N PSPC1 n/a
4 TRCN0000154409 GAGCTGCTAGAGCAAGCATTT pLKO.1 696 3UTR 100% 10.800 7.560 N PSPC1 n/a
5 TRCN0000338557 GAGCTGCTAGAGCAAGCATTT pLKO_005 696 3UTR 100% 10.800 7.560 N PSPC1 n/a
6 TRCN0000152218 CGGAAGCAAATACAACTAAGA pLKO.1 1221 3UTR 100% 4.950 3.465 N PSPC1 n/a
7 TRCN0000150790 GCAGTGTAATTCAGAAGAGTT pLKO.1 1391 3UTR 100% 4.950 3.465 N PSPC1 n/a
8 TRCN0000154609 GCTCTGGAAAGATGTGGTGAT pLKO.1 822 3UTR 100% 4.050 2.835 N PSPC1 n/a
9 TRCN0000154860 GCCTTGACTGTCAAGAACCTT pLKO.1 657 3UTR 100% 3.000 2.100 N PSPC1 n/a
10 TRCN0000151650 CTTTCTCCAGTTGTTTCCAAT pLKO.1 675 3UTR 100% 4.950 2.970 N PSPC1 n/a
11 TRCN0000102471 CCTGGGACATTTGAATTTGAA pLKO.1 990 3UTR 100% 5.625 3.938 N Pspc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003272.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10243 pDONR223 100% 70.2% None 1_188del;1368_1679del n/a
2 ccsbBroad304_10243 pLX_304 0% 70.2% V5 1_188del;1368_1679del n/a
3 TRCN0000478484 GGCGCCTTGTGGTGGTGCCAATAA pLX_317 29.6% 70.2% V5 1_188del;1368_1679del n/a
Download CSV