Transcript: Human NR_003277.1

Homo sapiens heterogeneous nuclear ribonucleoprotein A1 pseudogene 33 (HNRNPA1P33), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
HNRNPA1P33 (728643)
Length:
542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003277.1
NBCI Gene record:
HNRNPA1P33 (728643)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235098 ACCCATGAAGGGAGGAAATTT pLKO_005 364 3UTR 100% 15.000 7.500 Y HNRNPA1 n/a
2 TRCN0000241555 TGGTGGAAGCTACAATGATTT pLKO_005 310 3UTR 100% 13.200 6.600 Y HNRNPA1L2 n/a
3 TRCN0000006584 CGAAGTGGTTCTGGAAACTTT pLKO.1 128 3UTR 100% 5.625 2.813 Y HNRNPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003277.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00765 pDONR223 100% 47.8% None (many diffs) n/a
2 ccsbBroad304_00765 pLX_304 0% 47.8% V5 (many diffs) n/a
3 TRCN0000473586 GGTGGCTTCAACTTACTCATTGAC pLX_317 46.7% 47.8% V5 (many diffs) n/a
Download CSV