Transcript: Human NR_003284.1

Homo sapiens proliferation-associated 2G4 pseudogene 4 (PA2G4P4), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
PA2G4P4 (647033)
Length:
2751
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003284.1
NBCI Gene record:
PA2G4P4 (647033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294074 AGGACAGAGAACCACTATTTA pLKO_005 2009 3UTR 100% 15.000 7.500 Y PA2G4 n/a
2 TRCN0000050417 CCTGGTCGTGACCAAGTATAA pLKO.1 1334 3UTR 100% 13.200 6.600 Y PA2G4 n/a
3 TRCN0000236754 CCTGGTCGTGACCAAGTATAA pLKO_005 1334 3UTR 100% 13.200 6.600 Y Pa2g4 n/a
4 TRCN0000286798 CCTGGTCGTGACCAAGTATAA pLKO_005 1334 3UTR 100% 13.200 6.600 Y PA2G4 n/a
5 TRCN0000050414 GCAACCATTTAATGTTCTCTA pLKO.1 2195 3UTR 100% 4.950 2.475 Y PA2G4 n/a
6 TRCN0000031992 GCCCAGTTTAAATTTACAGTT pLKO.1 2238 3UTR 100% 4.950 2.475 Y Pa2g4 n/a
7 TRCN0000031990 GCCGTTTACTTTAAGAGCATT pLKO.1 2117 3UTR 100% 4.950 2.475 Y Pa2g4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003284.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01139 pDONR223 100% 41.8% None (many diffs) n/a
2 ccsbBroad304_01139 pLX_304 0% 41.8% V5 (many diffs) n/a
3 TRCN0000470667 AGTCTGAATACGAAAGTTATTGTG pLX_317 33.5% 41.8% V5 (many diffs) n/a
Download CSV