Transcript: Human NR_003370.2

Homo sapiens RRN3 homolog, RNA polymerase I transcription factor pseudogene 1 (RRN3P1), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
RRN3P1 (730092)
Length:
1628
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003370.2
NBCI Gene record:
RRN3P1 (730092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017978 CAAAGATGAAGACTTGTGGAT pLKO.1 1123 3UTR 100% 2.640 1.848 N RRN3P1 n/a
2 TRCN0000017981 TGAAGACTTGTGGATATGGAT pLKO.1 1129 3UTR 100% 3.000 1.800 N RRN3P1 n/a
3 TRCN0000017979 GCTGCACATATACCTTAATAA pLKO.1 869 3UTR 100% 15.000 7.500 Y RRN3P1 n/a
4 TRCN0000017980 GCTGTGTTCTACACCTTTGTT pLKO.1 957 3UTR 100% 5.625 2.813 Y RRN3P1 n/a
5 TRCN0000017982 CGGAAACCTGAAAGAAGGTTT pLKO.1 1001 3UTR 100% 0.495 0.248 Y RRN3P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003370.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03446 pDONR223 100% 57.9% None (many diffs) n/a
2 ccsbBroad304_03446 pLX_304 0% 57.9% V5 (many diffs) n/a
3 TRCN0000468173 TCTGCCCTTGTCCTTGCTGCACCC pLX_317 22.4% 57.9% V5 (many diffs) n/a
Download CSV