Transcript: Human NR_003509.1

Homo sapiens heat shock transcription factor Y-linked 2 (HSFY2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-06-12
Taxon:
Homo sapiens (human)
Gene:
HSFY2 (159119)
Length:
1496
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003509.1
NBCI Gene record:
HSFY2 (159119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017781 GCCAGATAAAGATGATGATTT pLKO.1 321 3UTR 100% 13.200 6.600 Y HSFY2 n/a
2 TRCN0000436375 GTGACCAATTCAAGTCTATTT pLKO_005 386 3UTR 100% 13.200 6.600 Y HSFY1 n/a
3 TRCN0000416329 GTTCGACAGCTCAACCTTTAT pLKO_005 520 3UTR 100% 13.200 6.600 Y HSFY2 n/a
4 TRCN0000418835 GACTCAGACTTACGGTCAATG pLKO_005 223 3UTR 100% 10.800 5.400 Y HSFY1 n/a
5 TRCN0000431462 TTGTTAGAAAGTCCAAGTTAC pLKO_005 283 3UTR 100% 10.800 5.400 Y HSFY2 n/a
6 TRCN0000017778 CGGTCAATGATTGAAGAACAT pLKO.1 235 3UTR 100% 4.950 2.475 Y HSFY2 n/a
7 TRCN0000017438 CCAAAGATGAATTAACTGCTT pLKO.1 155 3UTR 100% 2.640 1.320 Y HSFY1 n/a
8 TRCN0000017439 GATCCTTGTTAGAAAGTCCAA pLKO.1 278 3UTR 100% 2.640 1.320 Y HSFY1 n/a
9 TRCN0000017440 CACCTTTCTGTCAGAAGAGAT pLKO.1 588 3UTR 100% 4.950 2.475 Y HSFY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10279 pDONR223 100% 42.9% None 1_117del;760_1496del n/a
2 ccsbBroad304_10279 pLX_304 0% 42.9% V5 1_117del;760_1496del n/a
3 TRCN0000470618 TCACACGTATTCGAGTGCGCGGTC pLX_317 37.3% 42.9% V5 1_117del;760_1496del n/a
Download CSV