Construct: ORF TRCN0000470618
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000669.1_s317c1
- Derived from:
- ccsbBroadEn_10279
- DNA Barcode:
- TCACACGTATTCGAGTGCGCGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HSFY1 (86614)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470618
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 159119 | HSFY2 | heat shock transcription fa... | XM_017030031.2 | 100% | 100% | |
| 2 | human | 159119 | HSFY2 | heat shock transcription fa... | NM_001001877.1 | 88.2% | 82.7% | (many diffs) |
| 3 | human | 86614 | HSFY1 | heat shock transcription fa... | NM_152584.1 | 88.2% | 82.7% | (many diffs) |
| 4 | human | 86614 | HSFY1 | heat shock transcription fa... | NM_033108.2 | 49.6% | 44.5% | (many diffs) |
| 5 | human | 159119 | HSFY2 | heat shock transcription fa... | NM_153716.2 | 49.6% | 44.5% | (many diffs) |
| 6 | human | 86614 | HSFY1 | heat shock transcription fa... | NR_003510.1 | 43.4% | 1_97del;740_1476del | |
| 7 | human | 159119 | HSFY2 | heat shock transcription fa... | NR_003509.1 | 42.9% | 1_117del;760_1496del | |
| 8 | human | 159119 | HSFY2 | heat shock transcription fa... | XM_017030030.2 | 30.9% | 24.5% | (many diffs) |
| 9 | human | 86614 | HSFY1 | heat shock transcription fa... | XM_017030085.2 | 30.9% | 24.5% | (many diffs) |
| 10 | human | 159119 | HSFY2 | heat shock transcription fa... | XM_005262508.4 | 30.2% | 24.6% | (many diffs) |
| 11 | human | 86614 | HSFY1 | heat shock transcription fa... | XM_005262565.4 | 30.2% | 24.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 708
- ORF length:
- 642
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc acatgtttct tcagaaactc aagatgtttc ccccaaagat gaattaactg 121 cttcagaagc ctccactagg tctccattgt gtgaacacac cttccctggg gactcagact 181 tacggtcaat gattgaagaa catgcttttc aggttttgtc acaaggatcc ttgttagaaa 241 gtccaagtta cacagtttgt gtctctgagc cagataaaga tgatgatttt ctttctctga 301 actttcccag gaaactttgg aaaatagtgg aaagtgacca attcaagtct atttcatggg 361 atgagaatgg aacttgcata gtgattaatg aagaactctt caagaaagaa attttggaaa 421 caaaggctcc ttacagaata tttcaaactg atgctatcaa aagttttgtt cGACAGCTCA 481 ACCTTTATGG ATTTAGTAAA ATTCAACAGA ATTTTCAAAG ATCTGCCTTT CTAGCCACCT 541 TTCTGTCAGA AGAGAAAGAA TCGTCTGTCT TAAGCAAGCT TCATGTCTTT GTGTTTCACC 601 ACAGTCTATT TGGAGCAACA TTCGGAGAAC ATCACTTTCA GCCATGCCCT TTACCATCTG 661 GTAACAAGGC TCCCATTTCT ACTTGGAGTG GAGATTCCTG GTTGCTGTGC CCAACTTTCT 721 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 781 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 841 GTGGAAAGGA CGATCACACG TATTCGAGTG CGCGGTCACG CGTTAAGTCg acaatcaacc 901 tctggattac aaaatttgtg aaagatt