Transcript: Mouse NR_003559.1

Mus musculus mitochondrial ribosomal protein L48 (Mrpl48), non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Mrpl48 (52443)
Length:
933
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003559.1
NBCI Gene record:
Mrpl48 (52443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_003559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190951 CATCGGAAGATACAGACACTT pLKO.1 247 3UTR 100% 4.950 3.465 N Mrpl48 n/a
2 TRCN0000319805 CATCGGAAGATACAGACACTT pLKO_005 247 3UTR 100% 4.950 3.465 N Mrpl48 n/a
3 TRCN0000190590 GCAGAAAGTTATGCCCAGTAT pLKO.1 389 3UTR 100% 4.950 3.465 N Mrpl48 n/a
4 TRCN0000319821 GCAGAAAGTTATGCCCAGTAT pLKO_005 389 3UTR 100% 4.950 3.465 N Mrpl48 n/a
5 TRCN0000189747 GCAATCTTCCAGAAGGAGTCA pLKO.1 609 3UTR 100% 2.640 1.848 N Mrpl48 n/a
6 TRCN0000350193 GCAATCTTCCAGAAGGAGTCA pLKO_005 609 3UTR 100% 2.640 1.848 N Mrpl48 n/a
7 TRCN0000202082 CACTACAAGACAAAGCCCACT pLKO.1 221 3UTR 100% 2.160 1.512 N Mrpl48 n/a
8 TRCN0000319871 CACTACAAGACAAAGCCCACT pLKO_005 221 3UTR 100% 2.160 1.512 N Mrpl48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003559.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.